WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029435 Gene Name  Cbr-obr-3
Sequence Name  ? CBG07370 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable lipid binding activity. Is an ortholog of C. elegans obr-3. In C. elegans, obr-3 is involved in regulation of growth and transforming growth factor beta receptor signaling pathway. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07370b.1 CBG07370b.1   [unknown]
Transcript:CBG07370c.1 CBG07370c.1   [unknown]
Transcript:CBG07370a.1 CBG07370a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07370a CBG07370a   [unknown]
CDS:CBG07370b CBG07370b   [unknown]
CDS:CBG07370c CBG07370c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-obr-3, ATCTCCAACGAGGATCAGTACAAAGCCACCGAAGAGAAGACGGCTTTAGAGAACGACCAA, WBGene00029435   Expr1052260 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term