WormMine: Gene WBGene00029597

• WormBase Gene ID: WBGene00029597
• Gene Name: Cbr-nac-1
• Sequence Name: CBG07608
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transmembrane transporter activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans nac-1. In C. elegans, nac-1 is involved in succinate transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07608.1	CBG07608.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07608	CBG07608		[unknown]

0 RNAi Result

2 Allele

• WBVar00112608
• WBVar00112609

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066261
• Remark: Cbr-nac-1, AGTTGCTACTCCACCAAACGCCATTGTCTTCTCTTCTGGATACCTCAAAGTTTTTGATAT, WBGene00029597
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term