WormMine: Gene WBGene00029673

• WormBase Gene ID: WBGene00029673
• Gene Name: Cbr-gcy-36
• Sequence Name: CBG07710
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanylate cyclase activity and heme binding activity. Predicted to be involved in cGMP biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-36. In C. elegans, gcy-36 is involved in feeding behavior and response to oxygen levels.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07710a.1	CBG07710a.1		[unknown]
Transcript:CBG07710b.1	CBG07710b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07710b	CBG07710b		[unknown]
CDS:CBG07710a	CBG07710a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1060911
• Remark: Cbr-gcy-36, GAAAGTACCGGTCGGTTCGAATTCGAACCGCGTGGCAAGGTTCAAATCAAGGGAAAGGGC, WBGene00029673
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term