WormMine: Gene WBGene00029934

• WormBase Gene ID: WBGene00029934
• Gene Name: Cbr-vpat-1
• Sequence Name: CBG08069
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transmembrane transporter activity. Predicted to be involved in transmembrane transport. Is an ortholog of C. elegans vpat-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08069a.1	CBG08069a.1		[unknown]
Transcript:CBG08069b.1	CBG08069b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08069a	CBG08069a		[unknown]
CDS:CBG08069b	CBG08069b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051436
• Remark: CBG08069, TGGTGGAGAGAGTTGGATTTAGATGGACCACAACAATGATTGCATTCCTACACATAATAT, WBGene00029934
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term