WormMine: Gene WBGene00030071

• WormBase Gene ID: WBGene00030071
• Gene Name: Cbr-rbg-2
• Sequence Name: CBG08238
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Rab3 GTPase-activating protein regulatory subunit C-terminus; Rab3-GAP regulatory subunit, N-terminal; Rab3 GTPase-activating protein regulatory subunit N-terminus; Rab3GAP regulatory subunit; and Rab3GAP regulatory subunit, C-terminal. Is an ortholog of C. elegans rbg-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08238.1	CBG08238.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08238	CBG08238		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052519
• Remark: Cbr-rbg-2, AAGAAGCAGTGTCGTCACTTGGTAAAGCAGGAAATTCGGTGCCACAATCAGCGCAGGCCG, WBGene00030071
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term