WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030084 Gene Name  Cbr-jph-1
Sequence Name  ? CBG08257 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be part of junctional membrane complex. Is an ortholog of C. elegans jph-1. In C. elegans, jph-1 is involved in locomotion and positive regulation of engulfment of apoptotic cell. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08257.1 CBG08257.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08257 CBG08257   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-jph-1, AGAAGTGCTACGCGAACACGAAGAAGCGGCGCTACTCAGAGCAAATCCACTTCGACATTT, WBGene00030084   Expr1067983 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  part_of

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  part_of

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term