WormMine: Gene WBGene00030162

• WormBase Gene ID: WBGene00030162
• Gene Name: CBG08354
• Sequence Name: CBG08354
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity; ATP binding activity; and ATP hydrolysis activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans mrp-4. In C. elegans, mrp-4 is involved in lipid transport involved in lipid storage and lysosome organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08354.1	CBG08354.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08354	CBG08354		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1066735
• Remark: CBG08354, GTTCCGAATCATTGAAGCTGCAGAAGGTCTGATCACTCTGGATGGAATTAACTTGGCAGA, WBGene00030162
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term