WormMine: Gene WBGene00030171

• WormBase Gene ID: WBGene00030171
• Gene Name: CBG08367
• Sequence Name: CBG08367
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transmembrane transporter activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans T07G12.5; T07G12.4; and T07G12.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08367b.1	CBG08367b.1		[unknown]
Transcript:CBG08367a.1	CBG08367a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08367b	CBG08367b		[unknown]
CDS:CBG08367a	CBG08367a		[unknown]

0 RNAi Result

2 Allele

• WBVar00009319
• WBVar00009314

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1050155
• Remark: CBG08367, CCTGATGTGAAGCACAATGGCTATGCACTTCCTTCATGTGTCAATAGATTCTTCTTAAAG, WBGene00030171
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term