WormMine: Gene WBGene00030321

• WormBase Gene ID: WBGene00030321
• Gene Name: Cbr-parn-1
• Sequence Name: CBG08556
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable nucleic acid binding activity. Is an ortholog of C. elegans parn-1. In C. elegans, parn-1 is involved in RNA surveillance; mRNA catabolic process; and piRNA processing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08556a.1	CBG08556a.1		[unknown]
Transcript:CBG08556b.1	CBG08556b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08556a	CBG08556a		[unknown]
CDS:CBG08556b	CBG08556b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1057849
• Remark: CBG08556, TGTAATCACTATTGTCAGACGAGACTTACGTCCGATTGGGGAAGAAGAATTCAAGCATCA, WBGene00030321
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term