WormMine: Gene WBGene00030489

• WormBase Gene ID: WBGene00030489
• Gene Name: Cbr-catp-1
• Sequence Name: CBG08751
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and ATP hydrolysis activity. Predicted to be located in membrane. Expressed in several structures, including P1.p; P2.p; P9.p; excretory duct; and hypodermal cell. Is an ortholog of C. elegans catp-1. In C. elegans, catp-1 is involved in dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08751.1	CBG08751.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08751	CBG08751		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr4691
• Pattern: GFP was detected in epidermal cells including the head epidermal cells hyp1 to hyp5, the hyp7 syncytium, the tail epidermal cells hyp8 to hyp11, and the ventral Pn.p cells. GFP expression was also detected in the excretory duct cell.

• Primary Identifier: Expr1051003
• Remark: Cbr-catp-1, ATCGTCGGTCTCTATTTGTTGGCTTTCAACGAGATGCGTAAATATTTTATTCGAAACTTC, WBGene00030489
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term