WormMine: Gene WBGene00030496

• WormBase Gene ID: WBGene00030496
• Gene Name: Cbr-frm-1
• Sequence Name: CBG08758
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin binding activity and structural molecule activity. Predicted to be located in cytoskeleton. Is an ortholog of C. elegans frm-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08758b.1	CBG08758b.1		[unknown]
Transcript:CBG08758a.1	CBG08758a.1		[unknown]
Transcript:CBG08758e.1	CBG08758e.1		[unknown]
Transcript:CBG08758d.1	CBG08758d.1		[unknown]
Transcript:CBG08758c.1	CBG08758c.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08758a	CBG08758a		[unknown]
CDS:CBG08758e	CBG08758e		[unknown]
CDS:CBG08758d	CBG08758d		[unknown]
CDS:CBG08758c	CBG08758c		[unknown]
CDS:CBG08758b	CBG08758b		[unknown]

0 RNAi Result

2 Allele

• WBVar00010277
• WBVar00010282

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062276
• Remark: Cbr-frm-1, CAAATGAATCCGGATATGGTTGTGGAGAAGATTGAAGTCCGCCAGGAGACTACTCAATAA, WBGene00030496
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term