WormMine: Gene WBGene00030538

• WormBase Gene ID: WBGene00030538
• Gene Name: Cbr-elt-7
• Sequence Name: CBG08810
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Is an ortholog of C. elegans elt-7. In C. elegans, elt-7 is involved in endodermal cell fate determination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08810.1	CBG08810.1		[unknown]
Transcript:CBG08810.2	CBG08810.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08810	CBG08810		[unknown]

0 RNAi Result

11 Allele

• WBVar00114066
• WBVar00114065
• WBVar00114069
• WBVar00114068
• WBVar00114067
• WBVar00114073
• WBVar00114072
• WBVar00114071
• WBVar00114070
• WBVar00114075
• WBVar00114074

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061270
• Remark: Cbr-elt-7, TTCCGTCTGAACAAAGTCAAAAGACCCCTGGAACTCTGCAACACAGCGCCGAAAACACGA, WBGene00030538
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term