WormMine: Gene WBGene00030676

• WormBase Gene ID: WBGene00030676
• Gene Name: Cbr-swp-1
• Sequence Name: CBG09000
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Predicted to be involved in RNA processing. Is an ortholog of C. elegans swp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09000a.1	CBG09000a.1		[unknown]
Transcript:CBG09000c.1	CBG09000c.1		[unknown]
Transcript:CBG09000c.3	CBG09000c.3		[unknown]
Transcript:CBG09000c.2	CBG09000c.2		[unknown]
Transcript:CBG09000b.1	CBG09000b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09000c	CBG09000c		[unknown]
CDS:CBG09000a	CBG09000a		[unknown]
CDS:CBG09000b	CBG09000b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056806
• Remark: Cbr-swp-1, CCGAAAAGATCTTCAACTTCATTTTATGGATCCTCACAGTCCATATTACTCGTATTACCA, WBGene00030676
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term