WormMine: Gene WBGene00030937

• WormBase Gene ID: WBGene00030937
• Gene Name: Cbr-gcst-1
• Sequence Name: CBG09336
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable aminomethyltransferase activity. Predicted to be involved in glycine catabolic process. Is an ortholog of C. elegans gcst-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09336.1	CBG09336.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09336	CBG09336		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1050421
• Remark: CBG09336, AGAAGCTGGTTTGTGTCTATATGGATCTGATATTGATGAGAACACTACCCCAATCGAAGC, WBGene00030937
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term