WormMine: Gene WBGene00030970

• WormBase Gene ID: WBGene00030970
• Gene Name: Cbr-cft-1
• Sequence Name: CBG09374
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity; ATP binding activity; and ATP hydrolysis activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Expressed in excretory canal. Is an ortholog of C. elegans cft-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09374.1	CBG09374.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09374	CBG09374		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr4630
• Remark: Species: C. briggsae.
• Pattern: In C. briggsae, the gene expressed in: excretory cell.

• Primary Identifier: Expr1067331
• Remark: Cbr-cft-1, CTTTCTGTGTTCCGGAAAACTTTGTCAATCAACAGTTTCATGCATTCTCTCAATGTCACT, WBGene00030970
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term