WormMine: Gene WBGene00031017

• WormBase Gene ID: WBGene00031017
• Gene Name: Cbr-acly-2
• Sequence Name: CBG09435
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and ATP citrate synthase activity. Predicted to be involved in acetyl-CoA biosynthetic process and citrate metabolic process. Is an ortholog of C. elegans acly-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09435.1	CBG09435.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09435	CBG09435		[unknown]

0 RNAi Result

6 Allele

• WBVar00114881
• WBVar00114882
• WBVar00114883
• WBVar00114884
• WBVar00114880
• WBVar00114885

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated
	C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1064215
• Remark: CBG09435, CAACAGCCGAAGCTCAAGAAGTTATCGAGATAGGTGCTCTCAATGGAATGTTCGTTCTTG, WBGene00031017
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term