WormMine: Gene WBGene00031215

• WormBase Gene ID: WBGene00031215
• Gene Name: Cbr-mab-23
• Sequence Name: CBG09659
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans mab-23. In C. elegans, mab-23 is involved in several processes, including neuron fate determination; regulation of male mating behavior; and regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09659.1	CBG09659.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09659	CBG09659		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058580
• Remark: Cbr-mab-23, AGAGAAACCAAGTATTTTCCATTCCGCTGAAATGCTTGCCATTGGAGATTCAACTCAATA, WBGene00031215
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term