WormMine: Gene WBGene00031318

• WormBase Gene ID: WBGene00031318
• Gene Name: Cbr-mua-3
• Sequence Name: CBG09798
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans mua-3. In C. elegans, mua-3 is involved in cell-matrix adhesion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09798c.1	CBG09798c.1		[unknown]
Transcript:CBG09798a.1	CBG09798a.1		[unknown]
Transcript:CBG09798b.1	CBG09798b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09798c	CBG09798c		[unknown]
CDS:CBG09798a	CBG09798a		[unknown]
CDS:CBG09798b	CBG09798b		[unknown]

0 RNAi Result

39 Allele

• WBVar00115307
• WBVar00115308
• WBVar00115309
• WBVar00115303
• WBVar00115304
• WBVar00115305
• WBVar00115306
• WBVar00115310
• WBVar00115311
• WBVar00115312
• WBVar00115313
• WBVar00115300
• WBVar00115301
• WBVar00115302
• WBVar00115314
• WBVar00115315
• WBVar00115316
• WBVar00115317
• WBVar00115279
• WBVar00115291
• WBVar00115292
• WBVar00115293
• WBVar00115294
• WBVar00115290
• WBVar00115299
• WBVar00115295
• WBVar00115296
• WBVar00115297
• WBVar00115298
• WBVar00115280

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061943
• Remark: Cbr-mua-3, GTACACTTGCAAGTGTCCAGAAGGATACATCGATGGAAATCCAGACGAGCCAGGAAGAGT, WBGene00031318
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term