WormMine: Gene WBGene00031587

• WormBase Gene ID: WBGene00031587
• Gene Name: Cbr-emb-9
• Sequence Name: CBG10116
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be an extracellular matrix structural constituent. Predicted to be part of collagen trimer. Is an ortholog of C. elegans emb-9. In C. elegans, emb-9 is involved in several processes, including positive regulation of axon regeneration; positive regulation of protein secretion; and response to serotonin.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10116b.1	CBG10116b.1		[unknown]
Transcript:CBG10116a.1	CBG10116a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10116b	CBG10116b		[unknown]
CDS:CBG10116a	CBG10116a		[unknown]

0 RNAi Result

4 Allele

• WBVar00011227
• WBVar00011222
• WBVar00011217
• WBVar00011212

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058548
• Remark: Cbr-emb-9, GCAAACCAATGTCACAAACACTCAAGGCCGGAGGACTCAAAGATCGTGTGTCCAGATGCC, WBGene00031587
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term