WormMine: Gene WBGene00031821

• WormBase Gene ID: WBGene00031821
• Gene Name: CBG10433
• Sequence Name: CBG10433
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glucosylceramidase activity. Predicted to be involved in carbohydrate metabolic process and glucosylceramide catabolic process. Predicted to be located in membrane. Is an ortholog of C. elegans R08F11.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10433a.1	CBG10433a.1		[unknown]
Transcript:CBG10433b.1	CBG10433b.1		[unknown]
Transcript:CBG10433c.1	CBG10433c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10433c	CBG10433c		[unknown]
CDS:CBG10433a	CBG10433a		[unknown]
CDS:CBG10433b	CBG10433b		[unknown]

0 RNAi Result

2 Allele

• WBVar00011987
• WBVar00011982

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1063588
• Remark: CBG10433, CCAGAGTGAAGAAGTCTGGGCTGGCATCACTTATTCATTATCTGCGATGATGATTGAAAA, WBGene00031821
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term