WormMine: Gene WBGene00032220

• WormBase Gene ID: WBGene00032220
• Gene Name: Cbr-unc-10
• Sequence Name: CBG11009
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable small GTPase binding activity. Predicted to be involved in exocytosis. Predicted to be located in membrane. Is an ortholog of C. elegans unc-10. In C. elegans, unc-10 is involved in several processes, including chemical synaptic transmission; defecation; and positive regulation of cholinergic synaptic transmission.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11009b.1	CBG11009b.1		[unknown]
Transcript:CBG11009a.1	CBG11009a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11009a	CBG11009a		[unknown]
CDS:CBG11009b	CBG11009b		[unknown]

0 RNAi Result

2 Allele

• WBVar00116380
• WBVar00116379

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051644
• Remark: Cbr-unc-10, CGAACTTGGATCTCAACCGTTAATAGGATGGTACAAGTTATTTCATAGCTCCTCATTGGC, WBGene00032220
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term