WormMine: Gene WBGene00032363

• WormBase Gene ID: WBGene00032363
• Gene Name: Cbr-unc-104
• Sequence Name: CBG11201
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; microtubule binding activity; and microtubule motor activity. Predicted to be involved in microtubule-based movement. Is an ortholog of C. elegans unc-104. In C. elegans, unc-104 is involved in several processes, including chemical synaptic transmission; regulation of cellular component organization; and regulation of cellular localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11201d.1	CBG11201d.1		[unknown]
Transcript:CBG11201a.1	CBG11201a.1		[unknown]
Transcript:CBG11201b.1	CBG11201b.1		[unknown]
Transcript:CBG11201c.1	CBG11201c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11201b	CBG11201b		[unknown]
CDS:CBG11201a	CBG11201a		[unknown]
CDS:CBG11201d	CBG11201d		[unknown]
CDS:CBG11201c	CBG11201c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069499
• Remark: Cbr-unc-104, TCCAAATACATTCAGTGTTTGCACAAATCAGCGAGGATTTTTGATGCAGATGATGCCTGG, WBGene00032363
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term