Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG11421.1 | CBG11421.1 | [unknown] |
Other
22 Allele
| Public Name |
|---|
| WBVar00117076 |
| WBVar00117075 |
| WBVar00117078 |
| WBVar00117077 |
| WBVar00117079 |
| WBVar00117090 |
| WBVar00117085 |
| WBVar00117084 |
| WBVar00117087 |
| WBVar00117086 |
| WBVar00117081 |
| WBVar00117080 |
| WBVar00117083 |
| WBVar00117082 |
| WBVar00117089 |
| WBVar00117088 |
| WBVar00013062 |
| WBVar00013047 |
| WBVar00013057 |
| WBVar00013052 |
| WBVar00013037 |
| WBVar00013042 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-htz-1(gu167)_upregulated | |
| Virus infection: Santeuil infected at L3 larva stage for 12 hours. | Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. | edgeR, FDR < 0.05. | WBPaper00051137:Santeuil-virus_upregulated_JU1264 |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG11421, TGCCGCTCTCATGGCTCAGTGGTTCATTTTTGGAATCGTTACAGGAAACAAATTTATTGT, WBGene00032537 | Expr1052198 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |