WormMine: Gene WBGene00032797

• WormBase Gene ID: WBGene00032797
• Gene Name: CBG11717
• Sequence Name: CBG11717
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine phosphatase activity. Is an ortholog of C. elegans Y48G1C.5; Y22D7AR.12; and R06B10.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11717.1	CBG11717.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11717	CBG11717		[unknown]

0 RNAi Result

17 Allele

• WBVar00117427
• WBVar00117426
• WBVar00117429
• WBVar00117428
• WBVar00117430
• WBVar00117431
• WBVar00117419
• WBVar00117416
• WBVar00117415
• WBVar00117418
• WBVar00117417
• WBVar00117423
• WBVar00117422
• WBVar00117425
• WBVar00117424
• WBVar00117421
• WBVar00117420

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1054946
• Remark: CBG11717, ATGGGTGAAGAAAGCAGTCGATGGACAATCAGATTCCATTGCCAAAGCCCTCGATCAACT, WBGene00032797
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term