WormMine: Gene WBGene00032829

• WormBase Gene ID: WBGene00032829
• Gene Name: Cbr-tat-1
• Sequence Name: CBG11754
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP hydrolysis activity; ATPase-coupled intramembrane lipid transporter activity; and small molecule binding activity. Predicted to be involved in phospholipid transport. Predicted to be located in membrane. Is an ortholog of C. elegans tat-1. In C. elegans, tat-1 is involved in several processes, including lysosome organization; phospholipid translocation; and regulation of phagocytosis, engulfment.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11754b.1	CBG11754b.1		[unknown]
Transcript:CBG11754c.1	CBG11754c.1		[unknown]
Transcript:CBG11754a.1	CBG11754a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11754b	CBG11754b		[unknown]
CDS:CBG11754c	CBG11754c		[unknown]
CDS:CBG11754a	CBG11754a		[unknown]

0 RNAi Result

41 Allele

• WBVar00043612
• WBVar00117607
• WBVar00117606
• WBVar00117609
• WBVar00117608
• WBVar00117603
• WBVar00117602
• WBVar00117605
• WBVar00117604
• WBVar00117610
• WBVar00117612
• WBVar00117611
• WBVar00117601
• WBVar00117600
• WBVar00117618
• WBVar00117617
• WBVar00117619
• WBVar00117614
• WBVar00117613
• WBVar00117616
• WBVar00117615
• WBVar00117621
• WBVar00117620
• WBVar00117622
• WBVar00013737
• WBVar00013732
• WBVar00013727
• WBVar00013722
• WBVar00013717
• WBVar00013712

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056136
• Remark: Cbr-tat-1, TGATCAGATTATGAAGTATCCCGCGTTGTATGCCAGCTTCCAGAACAGAGCATTTAGTAT, WBGene00032829
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term