WormMine: Gene WBGene00032841

• WormBase Gene ID: WBGene00032841
• Gene Name: Cbr-wht-5
• Sequence Name: CBG11767
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity; ATP binding activity; and ATP hydrolysis activity. Predicted to be located in membrane. Is an ortholog of C. elegans wht-5. In C. elegans, wht-5 is involved in positive regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11767a.1	CBG11767a.1		[unknown]
Transcript:CBG11767b.1	CBG11767b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11767b	CBG11767b		[unknown]
CDS:CBG11767a	CBG11767a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064869
• Remark: Cbr-wht-5, TATTGTAGCTGCTCTTTTGTTCTGGAAGATTCTTGGGATTCTATCGTTTAGCTGGAGAAT, WBGene00032841
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term