WormMine: Gene WBGene00032921

• WormBase Gene ID: WBGene00032921
• Gene Name: Cbr-lrp-1
• Sequence Name: CBG11882
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans lrp-1. In C. elegans, lrp-1 is involved in several processes, including ecdysis, collagen and cuticulin-based cuticle; nematode larval development; and regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11882.1	CBG11882.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11882	CBG11882		[unknown]

0 RNAi Result

3 Allele

• WBVar00033529
• WBVar00005634
• WBVar00118027

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1059651
• Remark: Cbr-lrp-1, AGAATGAGGCAGCTGATGGAAGTGTGTCGTTCCATGGAAATGTCATTTCGTTTAGTAATC, WBGene00032921
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term