WormMine: Gene WBGene00033393

• WormBase Gene ID: WBGene00033393
• Gene Name: Cbr-nduf-7
• Sequence Name: CBG12445
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 4 iron, 4 sulfur cluster binding activity; NADH dehydrogenase (ubiquinone) activity; and quinone binding activity. Is an ortholog of C. elegans nduf-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12445.1	CBG12445.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12445	CBG12445		[unknown]

0 RNAi Result

1 Allele

• WBVar00014562

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067230
• Remark: Cbr-nduf-7, GAAGCCAAATGGGTGATTTCCATGGGATCGTGTGCGAACGGAGGAGGATATTATCACTAT, WBGene00033393
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term