WormMine: Gene WBGene00033632

• WormBase Gene ID: WBGene00033632
• Gene Name: Cbr-sod-2
• Sequence Name: CBG12726
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metal ion binding activity and superoxide dismutase activity. Predicted to be involved in superoxide metabolic process. Is an ortholog of C. elegans sod-2. In C. elegans, sod-2 is involved in removal of superoxide radicals.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12726.1	CBG12726.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12726	CBG12726		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051066
• Remark: Cbr-sod-2, TGGGAGCACGCATACTATTTGCAATACAAGAACGTTCGCCCAGACTACGTTAATGCTATC, WBGene00033632
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term