WormMine: Gene WBGene00033787

• WormBase Gene ID: WBGene00033787
• Gene Name: Cbr-slo-1
• Sequence Name: CBG12923
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable monoatomic ion channel activity. Predicted to be involved in potassium ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans slo-1. In C. elegans, slo-1 is involved in several processes, including behavioral response to ethanol; nematode pharyngeal pumping; and sarcomere organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12923h.1	CBG12923h.1		[unknown]
Transcript:CBG12923e.1	CBG12923e.1		[unknown]
Transcript:CBG12923d.1	CBG12923d.1		[unknown]
Transcript:CBG12923g.1	CBG12923g.1		[unknown]
Transcript:CBG12923f.1	CBG12923f.1		[unknown]
Transcript:CBG12923a.1	CBG12923a.1		[unknown]
Transcript:CBG12923c.1	CBG12923c.1		[unknown]
Transcript:CBG12923b.1	CBG12923b.1		[unknown]

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12923f	CBG12923f		[unknown]
CDS:CBG12923e	CBG12923e		[unknown]
CDS:CBG12923h	CBG12923h		[unknown]
CDS:CBG12923g	CBG12923g		[unknown]
CDS:CBG12923b	CBG12923b		[unknown]
CDS:CBG12923a	CBG12923a		[unknown]
CDS:CBG12923d	CBG12923d		[unknown]
CDS:CBG12923c	CBG12923c		[unknown]

0 RNAi Result

11 Allele

• WBVar00119165
• WBVar00119166
• WBVar00119163
• WBVar00119164
• WBVar00119161
• WBVar00119162
• WBVar00119160
• WBVar00119169
• WBVar00119167
• WBVar00119168
• WBVar00119159

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053253
• Remark: Cbr-slo-1, TTGTATTGGATTGTACAGGCTGCATGATCAAGACAATCCTGATTCCATGAAACGATATGT, WBGene00033787
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term