WormMine: Gene WBGene00033960

• WormBase Gene ID: WBGene00033960
• Gene Name: Cbr-rpb-4
• Sequence Name: CBG13151
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable nucleotide binding activity. Predicted to be involved in DNA-templated transcription initiation. Predicted to be part of RNA polymerase complex. Is an ortholog of C. elegans rpb-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13151.1	CBG13151.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13151	CBG13151		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068093
• Remark: Cbr-rpb-4, CTTCTCCGAGAAACATCTTCACAAGTTCGAAGTTGCTCAAATCGCAAATCTCTGCCCAGA, WBGene00033960
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term