WormMine: Gene WBGene00034014

• WormBase Gene ID: WBGene00034014
• Gene Name: Cbr-immp-1
• Sequence Name: CBG13223
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable serine-type endopeptidase activity. Predicted to be involved in signal peptide processing. Predicted to be located in membrane. Is an ortholog of C. elegans immp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13223.1	CBG13223.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13223	CBG13223		[unknown]

0 RNAi Result

1 Allele

• WBVar00015032

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052163
• Remark: Cbr-immp-1, TGGCCATTGGAACGGGCGGGATGGGTCAATGATCGCTGGTTCTGGGATAAAAGTAATTAA, WBGene00034014
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term