WormMine: Gene WBGene00034015

• WormBase Gene ID: WBGene00034015
• Gene Name: Cbr-gbf-1
• Sequence Name: CBG13224
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be involved in regulation of ARF protein signal transduction. Is an ortholog of C. elegans gbf-1. In C. elegans, gbf-1 is involved in several processes, including endoplasmic reticulum organization; endosomal transport; and mitochondrion organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13224.1	CBG13224.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13224	CBG13224		[unknown]

0 RNAi Result

10 Allele

• WBVar00119414
• WBVar00013569
• WBVar00013564
• WBVar00013559
• WBVar00013554
• WBVar00013549
• WBVar00013544
• WBVar00013539
• WBVar00015042
• WBVar00015037

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068214
• Remark: Cbr-gbf-1, TGCGGAGTTGATCGAAGTGGAAGACTATGTTGATGAAAAAGGATGGGTCAGCATTCAACG, WBGene00034015
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term