WormMine: Gene WBGene00034107

• WormBase Gene ID: WBGene00034107
• Gene Name: CBG13328
• Sequence Name: CBG13328
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable uracil DNA N-glycosylase activity. Predicted to be involved in base-excision repair. Is an ortholog of C. elegans ung-1. In C. elegans, ung-1 is involved in base-excision repair.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13328.1	CBG13328.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13328	CBG13328		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059013
• Remark: Cbr-ung-1, TTTTGGTGGGGCTGCAAATGCTTTTCGAAATGCAACACGGAGCTGGAGAATTCAGGAAGA, WBGene00034107
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term