WormMine: Gene WBGene00034409

• WormBase Gene ID: WBGene00034409
• Gene Name: Cbr-sta-1
• Sequence Name: CBG13675
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription and signal transduction. Is an ortholog of C. elegans sta-1. In C. elegans, sta-1 is involved in dauer larval development and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13675a.1	CBG13675a.1		[unknown]
Transcript:CBG13675b.1	CBG13675b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13675a	CBG13675a		[unknown]
CDS:CBG13675b	CBG13675b		[unknown]

0 RNAi Result

56 Allele

• WBVar00045452
• WBVar00045442
• WBVar00045447
• WBVar00045462
• WBVar00045457
• WBVar00045467
• WBVar00045407
• WBVar00045402
• WBVar00045417
• WBVar00045412
• WBVar00045422
• WBVar00045427
• WBVar00045432
• WBVar00045437
• WBVar00045372
• WBVar00045367
• WBVar00045382
• WBVar00045377
• WBVar00045392
• WBVar00045397
• WBVar00045387
• WBVar00045322
• WBVar00045327
• WBVar00045342
• WBVar00045332
• WBVar00045337
• WBVar00045352
• WBVar00045347
• WBVar00045362
• WBVar00045357

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068659
• Remark: Cbr-sta-1, TTGGGTCCCGCTTTCAAAAATCCCACGTTCCATCCACACGACCAACAACAACACCTTCAA, WBGene00034409
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term