WormMine: Gene WBGene00034451

• WormBase Gene ID: WBGene00034451
• Gene Name: Cbr-pkd-2
• Sequence Name: CBG13737
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Predicted to be located in membrane. Is an ortholog of C. elegans pkd-2. In C. elegans, pkd-2 is involved in calcium ion transport; response to hermaphrodite contact; and vulval location.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13737.1	CBG13737.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13737	CBG13737		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059648
• Remark: Cbr-pkd-2, CAAACGTCCAGATGGACCATCAGAGGATGCAACTTATGAGGATTACAAGATCATGTTGTA, WBGene00034451
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term