WormMine: Gene WBGene00034652

• WormBase Gene ID: WBGene00034652
• Gene Name: Cbr-plx-1
• Sequence Name: CBG13987
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable semaphorin receptor activity. Predicted to be involved in semaphorin-plexin signaling pathway. Is an ortholog of C. elegans plx-1. In C. elegans, plx-1 is involved in epidermis development; nematode male tail mating organ morphogenesis; and nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13987a.1	CBG13987a.1		[unknown]
Transcript:CBG13987b.1	CBG13987b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13987a	CBG13987a		[unknown]
CDS:CBG13987b	CBG13987b		[unknown]

0 RNAi Result

9 Allele

• WBVar00120720
• WBVar00120721
• WBVar00120722
• WBVar00120723
• WBVar00120724
• WBVar00120725
• WBVar00120726
• WBVar00120392
• WBVar00120385

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058095
• Remark: Cbr-plx-1, AGTATATGTTTGACTTTATGGATGAACAAGCCAGAGAACACGGTATCATAGACCCGGAAG, WBGene00034652
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term