WormMine: Gene WBGene00034702

• WormBase Gene ID: WBGene00034702
• Gene Name: CBG14081
• Sequence Name: CBG14081
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans F53B1.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14081c.1	CBG14081c.1		[unknown]
Transcript:CBG14081b.1	CBG14081b.1		[unknown]
Transcript:CBG14081a.1	CBG14081a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14081c	CBG14081c		[unknown]
CDS:CBG14081b	CBG14081b		[unknown]
CDS:CBG14081a	CBG14081a		[unknown]

0 RNAi Result

9 Allele

• WBVar00138009
• WBVar00138011
• WBVar00138010
• WBVar00138013
• WBVar00138012
• WBVar00138015
• WBVar00138014
• WBVar00138017
• WBVar00138016

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062702
• Remark: CBG14081, TTTTACAATCAGCGGACAGGTTATTACATTGGGAATCTTGATTGTGGTTCTGATGATTTT, WBGene00034702
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term