WormMine: Gene WBGene00034941

• WormBase Gene ID: WBGene00034941
• Gene Name: CBG14449
• Sequence Name: CBG14449
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable histone methyltransferase activity and zinc ion binding activity. Predicted to be located in nucleus. Is an ortholog of C. elegans set-25. In C. elegans, set-25 is involved in negative regulation of gene expression, epigenetic.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14449.1	CBG14449.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14449	CBG14449		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061654
• Remark: CBG14449, GTTGCTTCGAATCAGATCCACTGATTCCTAAGATTGCGGTCTTTGCTCTTCGAGATATTG, WBGene00034941
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term