WormMine: Gene WBGene00035077

• WormBase Gene ID: WBGene00035077
• Gene Name: CBG14649
• Sequence Name: CBG14649
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be involved in small GTPase-mediated signal transduction. Is an ortholog of C. elegans Y34B4A.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14649.1	CBG14649.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14649	CBG14649		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061184
• Remark: CBG14649, AATGGCTTCAAAGATCGCGTTGATGAGGAGCGCACCTGGCAACTATCTCATCAGATCAAA, WBGene00035077
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term