WormMine: Gene WBGene00035078

• WormBase Gene ID: WBGene00035078
• Gene Name: Cbr-rga-8
• Sequence Name: CBG14650
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans rga-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14650a.2	CBG14650a.2		[unknown]
Transcript:CBG14650a.1	CBG14650a.1		[unknown]
Transcript:CBG14650b.1	CBG14650b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14650a	CBG14650a		[unknown]
CDS:CBG14650b	CBG14650b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070113
• Remark: CBG14650, TGACGAGAAACACTATCACAACGATCCACATGCAATTGCTTCCACTCTCAAAGCGTATCT, WBGene00035078
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term