WormMine: Gene WBGene00035176

• WormBase Gene ID: WBGene00035176
• Gene Name: Cbr-egl-6
• Sequence Name: CBG14781
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled peptide receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans egl-6. In C. elegans, egl-6 is involved in negative regulation of egg-laying behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14781.1	CBG14781.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14781	CBG14781		[unknown]

0 RNAi Result

1 Allele

• WBVar00121745

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055877
• Remark: CBG14781, GTTGGAAGAATCGTCATGAAGAAGCGTCAAAGTCCCCACGAACTTTCCTCATCAACGGAA, WBGene00035176
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term