WormMine: Gene WBGene00035293

• WormBase Gene ID: WBGene00035293
• Gene Name: Cbr-pamn-1
• Sequence Name: CBG14919
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable copper ion binding activity and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen. Predicted to be involved in peptide metabolic process. Predicted to be located in membrane. Is an ortholog of C. elegans pamn-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14919b.1	CBG14919b.1		[unknown]
Transcript:CBG14919a.1	CBG14919a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14919a	CBG14919a		[unknown]
CDS:CBG14919b	CBG14919b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059390
• Remark: CBG14919, GAGTCTCACCCGATGGAGATCAAATATTTGTGGGAGATATTGCTGAGGGCAAAGCAAGAC, WBGene00035293
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term