WormMine: Gene WBGene00036188

• WormBase Gene ID: WBGene00036188
• Gene Name: Cbr-apa-2
• Sequence Name: CBG16158
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable clathrin adaptor activity. Predicted to be involved in clathrin-dependent endocytosis and intracellular protein transport. Predicted to be part of AP-2 adaptor complex. Is an ortholog of C. elegans apa-2. In C. elegans, apa-2 is involved in embryo development; endocytosis; and protein localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16158.1	CBG16158.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16158	CBG16158		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052195
• Remark: Cbr-apa-2, CGCTCCAGCAAGGACACAGTCGTGCAGACATTGGTCGACTTATTGGGCAACCAATTTTAA, WBGene00036188
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term