WormMine: Gene WBGene00036222

• WormBase Gene ID: WBGene00036222
• Gene Name: CBG16200
• Sequence Name: CBG16200
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein kinase activity. Is an ortholog of C. elegans B0198.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16200.1	CBG16200.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16200	CBG16200		[unknown]

0 RNAi Result

23 Allele

• WBVar00055514
• WBVar00055509
• WBVar00055504
• WBVar00055499
• WBVar00055489
• WBVar00055494
• WBVar00123653
• WBVar00023644
• WBVar00023614
• WBVar00023649
• WBVar00023619
• WBVar00023654
• WBVar00023624
• WBVar00023659
• WBVar00023629
• WBVar00023599
• WBVar00023664
• WBVar00023634
• WBVar00020722
• WBVar00023604
• WBVar00023669
• WBVar00023639
• WBVar00023609

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057589
• Remark: CBG16200, GAAGAGTTTCCATTCGGTTTAGTCAGTTTGCTGAGCAAATTGCTTCTGCTCTAGAGCATC, WBGene00036222
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term