WormMine: Gene WBGene00036319

• WormBase Gene ID: WBGene00036319
• Gene Name: Cbr-cah-3
• Sequence Name: CBG16360
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable carbonate dehydratase activity and zinc ion binding activity. Is an ortholog of C. elegans cah-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16360b.1	CBG16360b.1		[unknown]
Transcript:CBG16360a.2	CBG16360a.2		[unknown]
Transcript:CBG16360a.1	CBG16360a.1		[unknown]
Transcript:CBG16360a.3	CBG16360a.3		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16360b	CBG16360b		[unknown]
CDS:CBG16360a	CBG16360a		[unknown]

0 RNAi Result

4 Allele

• WBVar00056008
• WBVar00024864
• WBVar00024869
• WBVar00021112

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053935
• Remark: Cbr-cah-3, GTAACCCATGATCAGCTGGAGCTATTCCGTCAAGTTCAGGATATTGATAAGCGTCCAATC, WBGene00036319
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term