WormMine: Gene WBGene00036328

• WormBase Gene ID: WBGene00036328
• Gene Name: Cbr-let-2
• Sequence Name: CBG16372
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be an extracellular matrix structural constituent. Predicted to be part of collagen trimer. Is an ortholog of C. elegans let-2. In C. elegans, let-2 is involved in several processes, including embryo development; gonad morphogenesis; and regulation of distal tip cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16372c.1	CBG16372c.1		[unknown]
Transcript:CBG16372b.1	CBG16372b.1		[unknown]
Transcript:CBG16372a.1	CBG16372a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16372c	CBG16372c		[unknown]
CDS:CBG16372a	CBG16372a		[unknown]
CDS:CBG16372b	CBG16372b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057682
• Remark: Cbr-let-2, AAACACTCAAGTCAGGAAATCTCCGCACCCGCGTCTCCAGATGCCAAGTCTGTGTCAAAT, WBGene00036328
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term