WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036328 Gene Name  Cbr-let-2
Sequence Name  ? CBG16372 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be an extracellular matrix structural constituent. Predicted to be part of collagen trimer. Is an ortholog of C. elegans let-2. In C. elegans, let-2 is involved in several processes, including embryo development; gonad morphogenesis; and regulation of distal tip cell migration. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16372c.1 CBG16372c.1   [unknown]
Transcript:CBG16372b.1 CBG16372b.1   [unknown]
Transcript:CBG16372a.1 CBG16372a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16372c CBG16372c   [unknown]
CDS:CBG16372a CBG16372a   [unknown]
CDS:CBG16372b CBG16372b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-let-2, AAACACTCAAGTCAGGAAATCTCCGCACCCGCGTCTCCAGATGCCAAGTCTGTGTCAAAT, WBGene00036328   Expr1057682 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  part_of

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  part_of

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term