WormMine: Gene WBGene00036418

• WormBase Gene ID: WBGene00036418
• Gene Name: Cbr-lgc-38
• Sequence Name: CBG16500
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GABA-A receptor activity and extracellular ligand-gated monoatomic ion channel activity. Predicted to be involved in monoatomic ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans lgc-38.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16500a.1	CBG16500a.1		[unknown]
Transcript:CBG16500b.1	CBG16500b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16500b	CBG16500b		[unknown]
CDS:CBG16500a	CBG16500a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051468
• Remark: Cbr-lgc-38, CCATGGTTCCAATGCCACCGATCCCATTCAAACCACAAAATGGAGCATGGGGAAAAGTGA, WBGene00036418
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term