WormMine: Gene WBGene00036438

• WormBase Gene ID: WBGene00036438
• Gene Name: Cbr-wip-1
• Sequence Name: CBG16525
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin binding activity. Is an ortholog of C. elegans wip-1. In C. elegans, wip-1 is involved in embryonic body morphogenesis; regulation of cell migration; and regulation of protein stability.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16525a.1	CBG16525a.1		[unknown]
Transcript:CBG16525b.1	CBG16525b.1		[unknown]
Transcript:CBG16525c.1	CBG16525c.1		[unknown]
Transcript:CBG16525d.1	CBG16525d.1		[unknown]
Transcript:CBG16525e.1	CBG16525e.1		[unknown]
Transcript:CBG16525f.1	CBG16525f.1		[unknown]

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16525f	CBG16525f		[unknown]
CDS:CBG16525e	CBG16525e		[unknown]
CDS:CBG16525d	CBG16525d		[unknown]
CDS:CBG16525c	CBG16525c		[unknown]
CDS:CBG16525b	CBG16525b		[unknown]
CDS:CBG16525a	CBG16525a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070056
• Remark: Cbr-wip-1, CACAAGCGAGTTCTCCGTATCCTGGAATGATGTCTACGGCAACAGTTTCTGCGAATGTGC, WBGene00036438
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term