WormMine: Gene WBGene00036477

• WormBase Gene ID: WBGene00036477
• Gene Name: Cbr-rbf-1
• Sequence Name: CBG16576
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in exocytosis. Predicted to be located in membrane and synaptic vesicle. Is an ortholog of C. elegans rbf-1. In C. elegans, rbf-1 is involved in dense core granule exocytosis and positive regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

11 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16576a.1	CBG16576a.1		[unknown]
Transcript:CBG16576b.1	CBG16576b.1		[unknown]
Transcript:CBG16576c.1	CBG16576c.1		[unknown]
Transcript:CBG16576d.1	CBG16576d.1		[unknown]
Transcript:CBG16576e.1	CBG16576e.1		[unknown]
Transcript:CBG16576f.1	CBG16576f.1		[unknown]
Transcript:CBG16576g.1	CBG16576g.1		[unknown]
Transcript:CBG16576h.1	CBG16576h.1		[unknown]
Transcript:CBG16576i.1	CBG16576i.1		[unknown]
Transcript:CBG16576j.1	CBG16576j.1		[unknown]
Transcript:CBG16576k.1	CBG16576k.1		[unknown]

Other

11 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16576j	CBG16576j		[unknown]
CDS:CBG16576i	CBG16576i		[unknown]
CDS:CBG16576h	CBG16576h		[unknown]
CDS:CBG16576g	CBG16576g		[unknown]
CDS:CBG16576k	CBG16576k		[unknown]
CDS:CBG16576b	CBG16576b		[unknown]
CDS:CBG16576a	CBG16576a		[unknown]
CDS:CBG16576f	CBG16576f		[unknown]
CDS:CBG16576e	CBG16576e		[unknown]
CDS:CBG16576d	CBG16576d		[unknown]
CDS:CBG16576c	CBG16576c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1053845
• Remark: CBG16580, TTTTATGTTGGATCTACCTGTGGTTTCGACTAGATGTAAGTCTTGTTTGGAAAAAACTTC, WBGene00036478
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1050783
• Remark: Cbr-rbf-1, AATGTATCGAAAATCCGGGAACTTTAGTTGAAGCGTGGCATCGTCTAGAATTGGATTCGT, WBGene00036477
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term